본문 바로가기
컴퓨터/C & C++

[cpp] FASTA 파일을 인덱스를 사용하여 읽는 방법

by HanJoohyun 2024. 6. 20.
반응형

 

들어가며

안녕하세요 한주현입니다

 

오늘은 cpp로 fasta 파일을 읽는데 index를 사용하여 전체 파일을 읽지 않고,

미리 인덱스 파일을 읽어 해당 위치로 이동하여 읽을 수 있는 코드에 대해 말해보겠습니다.

 

FASTA 파일 설명

먼저 FASTA 파일과 FASTA 파일의 index 파일에 대해서 설명해보겠습니다.

FASTA 파일은 아래와 같이 생겼습니다.

 

> 로 시작하는 header 줄이 있고

 

그 다음은 염기서열이 있는 줄 들이 있습니다.

각각의 >header 와 서열들을 하나의 record라고 부릅니다.

FASTA 파일에는 하나의 record가 들어있을 수도 있고 여러개의 records가 있을 수도 있습니다.

예시에서는 세 개의 records가 있고 각각의 record는 한 줄의 염기 개수가 60자로 되어있습니다.

$ cat sample.fasta
>sample1
CCTGCGGAAGATCGGCACTAGAATAGCCAGAACCGTTTCTCTGAGGCTTCCGGCCTTCCC
TCCCACTAATAATTCTGAGG
>sample2
CCATCGGTAGCGCATCCTTAGTCCAATTAAGTCCCTATCCAGGCGCTCCGCCGAAGGTCT
ATATCCATTTGTCAGCAGACACGC
>sample3
CCACCCTCGTGGTATGGCTAGGCATTCAGGAACCGGAGAACGCTTCAGACCAGCCCGGAC
TGGGAACCTGCGGGCAGTAGGTGGAAT                                                                                                                                                

samtools를 사용하여 FASTA 파일의 indexing을 해보겠습니다.

$ samtools faidx sample.fasta

FASTA 파일이 indexing이 되었습니다.

이 파일을 살펴보면 아래 와 같이 생겼습니다.

$ cat sample.fasta.fai
sample1 80      9       60      61
sample2 84      100     60      61
sample3 87      195     60      61

첫 번째 컬럼은 header 줄에 있는 내용.

두 번째 컬럼은 각 record에 해당하는 염기서열의 숫자.

세 번째 컬럼은 각 record의 염기서열이 시작하는 offset.

네 번째 컬럼은 한 줄에 포함된 염기서열의 개수.

마지막 컬럼은 한 줄에 포함된 염기서열의 개수와 가장 끝의 new line의 개수까지 포함한 값.

입니다.

 

파일을 전체를 읽지 않고 원하는 부분만 읽을 수 있는 전략

예를 들어 >sample1 의 offset, 즉 record에서 염기서열이 시작하는 지점은 9 입니다.

그 이유는 >sample1\n 의 각각 character 개수를 세어본다면 9 글자 이기 때문입니다.

그래서 9번째 부터 읽게 되면 sample1의 record의 염기를 읽을 수 있습니다.

 

 

cpp 코드

#include <fstream>
#include <iostream>
#include <sstream>
inline int ROW = 5;
/**
* @brief split a string by a delimiter
*
* @param s
* @param delim
* @param tokens
* @return true if the string is split successfully
* @return false if the string is not split successfully
*/
bool split(const std::string &s, char delim, std::vector<std::string> &tokens) {
std::string token;
std::istringstream iss(s);
while (std::getline(iss, token, delim)) {
tokens.push_back(token);
}
return true;
}
/**
* @brief read the index file
*
* @param filename
* @param positions
* @return true if the index file is read successfully
* @return false if the index file is not read successfully
*/
bool read_index(const std::string &filename,
std::vector<std::pair<std::string, int>> &positions) {
std::ifstream ifs(filename);
if (!ifs.is_open()) {
std::cerr << "Error: cannot open file " << filename << std::endl;
return false;
}
std::string line;
while (std::getline(ifs, line)) {
std::vector<std::string> tokens;
split(line, '\t', tokens);
std::pair<std::string, int> p = {tokens[0], std::stoi(tokens[2])};
positions.push_back(p);
}
return true;
}
/**
* @brief read the fasta file with an offset
*
* @param fasta_filepath
* @param seq
* @param offset
* @return true if the fasta file is read successfully
* @return false if the fasta file is not read successfully
*/
bool read_fasta(const std::string &fasta_filepath, std::string &seq,
int &offset) {
std::ifstream ifs(fasta_filepath);
if (!ifs.is_open()) {
std::cerr << "Error: cannot open file " << fasta_filepath << std::endl;
return false;
}
char *buffer = new char[ROW];
ifs.seekg(offset, std::ios::beg);
ifs.read(buffer, ROW);
ifs.close();
seq = buffer;
delete[] buffer;
return true;
}
int main(int argc, char *argv[]) {
if (argc != 3) {
std::cerr << "#usage: " << argv[0] << " <reference.fasta> <chromosome>"
<< std::endl;
return -1;
}
std::string fasta_filepath = argv[1];
std::string chromosome = argv[2];
std::string fasta_index_filepath = fasta_filepath + ".fai";
std::vector<std::pair<std::string, int>> positions;
if (!read_index(fasta_index_filepath, positions)) {
return -1;
}
for (auto &p : positions) {
if (p.first == chromosome) {
std::string seq;
int offset = p.second;
read_fasta(fasta_filepath, seq, offset);
std::cout << seq << std::endl;
break;
}
}
return 0;
}

이번 글에서 핵심적이라고 말할 수 있는 부분은 

read_fasta 함수에서 ifs.seekg(offset, std::ios::beg) 부분입니다.

 

offset만큼을 이동하여 읽는 부분으로

이렇게 하게 되면 일반적으로 human reference genome fasta 파일이 3GB 인데 이를 전부 읽지 않고도 특정 위치만 읽어낼 수 있습니다.

즉 메모리 효율적으로 읽을 수 있다는 점이죠.

 

오늘은 offset을 사용하여 FASTA 파일을 읽는 방법에 대해 알아보았습니다.

 

여러분들께 도움이 되셨으면 합니다.

 

그럼 다음 포스팅에서 또 만나요.

 

반응형

댓글